FlyBase .. Aberrations .. Anatomy .. BLAST .. Genes .. Annotation/Sequences .. Gene Products .. Maps .. People .. References .. Stocks .. Transgenes/Transposons .|. Help .. Searches .. News .. Site

Description of SO

GENERIC FEATURE FORMAT VERSION 3

SUMMARY

Author:  Lincoln Stein
Date:    30 September 2004
Version: 1.00

Although there are many richer ways of representing genomic features
via XML, the stubborn persistence of a variety of ad-hoc tab-delimited
flat file formats declares the bioinformatics community's need for a
simple format that can be modified with a text editor and processed
with shell tools like grep.  The GFF format, although widely used, has
fragmented into multiple incompatible dialects.  When asked why they
have modified the published Sanger specification, bioinformaticists
frequently answer that the format was insufficient for their needs,
and they needed to extend it.  The proposed GFF3 format addresses the
most common extensions to GFF, while preserving backward compatibility
with previous formats. The new format:

    1) adds a mechanism for representing more than one level 
       of hierarchical grouping of features and subfeatures.
    2) separates the ideas of group membership and feature name/id
    3) constrains the feature type field to be taken from a controlled
       vocabulary.
    4) allows a single feature, such as an exon, to belong to more than
       one group at a time.
    5) provides an explicit convention for pairwise alignments
    6) provides an explicit convention for features that occupy disjunct regions

DESCRIPTION OF THE FORMAT
-------------------------

The format consists of 9 columns, separated by tabs (NOT spaces).  The
following unescaped characters are allowed within fields:
[a-zA-Z0-9. :^*$@!+_?-].  All other characters must must be escaped
using the URL escaping conventions.  Unescaped quotation marks,
backslashes and other ad-hoc escaping conventions that have been added
to the GFF format are explicitly forbidden.  The =, ; and % characters
have reserved meanings as described below, and must be escaped when
used in other contexts.  Note that unescaped spaces are allowed within
fields.  Parsers must split on tabs, not spaces.

Undefined fields are replaced with the "." character, as described in
the original GFF spec.

Column 1: "seqid"

The ID of the landmark used to establish the coordinate system for the
current feature. IDs may contain any characters, but must escape any
characters not in the set [a-zA-Z0-9.:^*$@!+_?-].  In particular, IDs
may not contain unescaped whitespace and must not begin with an
unescaped ">".

Column 2: "source"

The source is a free text qualifier intended to describe the algorithm
or operating procedure that generated this feature.  Typically this is
the name of a piece of software, such as "Genescan" or a database
name, such as "Genbank."  In effect, the source is used to extend the
feature ontology by adding a qualifier to the type creating a new
composite type that is a subclass of the type in the type column.

Column 3: "type"

The type of the feature (previously called the "method").  This is
constrained to be either: (a) a term from the "lite" sequence
ontology, SOFA; or (b) a SOFA accession number.  The latter
alternative is distinguished using the syntax SO:000000.

Columns 4 & 5: "start" and "end"

The start and end of the feature, in 1-based integer coordinates,
relative to the landmark given in column 1.  Start is always less than
or equal to end.

For zero-length features, such as insertion sites, start equals end
and the implied site is to the right of the indicated base in the
direction of the landmark.

Column 6: "score"

The score of the feature, a floating point number.  As in earlier
versions of the format, the semantics of the score are ill-defined.
It is strongly recommended that E-values be used for sequence
similarity features, and that P-values be used for ab initio gene
prediction features.

Column 7: "strand"

The strand of the feature.  + for positive strand (relative to the
landmark), - for minus strand, and . for features that are not
stranded.  In addition, ? can be used for features whose strandedness
is relevant, but unknown.

Column 8: "phase"

For features of type "exon", the phase indicates where the feature
begins with reference to the reading frame.  The phase is one of the
integers 0, 1,or 2, indicating that the first base of the feature
corresponds to the first, second or last base of the codon,
respectively.  This is NOT to be confused with the frame, but relates
to the relative position of the translational start in whatever strand
the feature is in.

Column 9: "attributes"

A list of feature attributes in the format tag=value.  Multiple
tag=value pairs are separated by semicolons.  URL escaping rules are
used for tags or values containing the following characters: ",=;".
Spaces are allowed in this field, but tabs must be replaced with the
%09 URL escape.

These tags have predefined meanings:

    ID	   Indicates the name of the feature.  IDs must be unique
	   within the scope of the GFF file.

    Name   Display name for the feature.  This is the name to be
           displayed to the user.  Unlike IDs, there is no requirement
	   that the Name be unique within the file.

    Alias  A secondary name for the feature.  It is suggested that
	   this tag be used whenever a secondary identifier for the
	   feature is needed, such as locus names and
	   accession numbers.  Unlike ID, there is no requirement
	   that Alias be unique within the file.

    Parent Indicates the parent of the feature.  A parent ID can be
	   used to group exons into transcripts, transcripts into
	   genes, an so forth.  A feature may have multiple parents.
	   Parent can *only* be used to indicate a partof 
	   relationship.

    Target Indicates the target of a nucleotide-to-nucleotide or
	   protein-to-nucleotide alignment.  The format of the
	   value is "target_id start end [strand]", where strand
	   is optional and may be "+" or "-".  If the target_id 
	   contains spaces, they must be escaped as hex escape %20.

    Gap   The alignment of the feature to the target if the two are
          not colinear (e.g. contain gaps).  The alignment format is
	  taken from the CIGAR format described in the 
	  Exonerate documentation.
	  (http://cvsweb.sanger.ac.uk/cgi-bin/cvsweb.cgi/exonerate
           ?cvsroot=Ensembl).  See "THE GAP ATTRIBUTE" for a description
	   of this format.

    Note   A free text note.

    Dbxref A database cross reference.  See the section
	   "Ontology Associations and Db Cross References" for
	   details on the format.

    Ontology_term  A cross reference to an ontology term.  See
           the section "Ontology Associations and Db Cross References"
	   for details.

Multiple attributes of the same type are indicated by separating the
values with the comma "," character, as in:

       Parent=AF2312,AB2812,abc-3

Note that attribute names are case sensitive.  "Parent" is not the
same as "parent".

All attributes that begin with an uppercase letter are reserved for
later use.  Attributes that begin with a lowercase letter can be used
freely by applications.

THE CANONICAL GENE
------------------

To illustrate how a canonical gene should be represented consider
Figure 1 (canonical_gene.png).  This indicates a gene named EDEN
extending from position 1000 to position 9000.  It encodes three
alternatively-spliced transcripts named EDEN.1, EDEN.2 and EDEN.3.  It
also has an identified transcriptional factor binding site located 50
bp upstream from the transcriptional start site of EDEN.1 and EDEN2.

Here is how this gene should be described using GFF3:

 0  ##gff-version   3
 1  ##sequence-region   ctg123 1 1497228       
 2  ctg123 . gene            1000  9000  .  +  .  ID=gene00001;Name=EDEN
 3  ctg123 . TF_binding_site 1000  1012  .  +  .  ID=tfbs00001;Parent=gene00001

 4  ctg123 . mRNA            1050  9000  .  +  .  ID=mRNA00001;Parent=gene00001;Name=EDEN.1
 5  ctg123 . five_prime_UTR  1050  1200  .  +  .  Parent=mRNA0001
 6  ctg123 . CDS             1201  1500  .  +  0  Parent=mRNA0001
 7  ctg123 . CDS             3000  3902  .  +  0  Parent=mRNA0001
 8  ctg123 . CDS             5000  5500  .  +  0  Parent=mRNA0001
 9  ctg123 . CDS             7000  7600  .  +  0  Parent=mRNA0001
10  ctg123 . three_prime_UTR 7601  9000  .  +  .  Parent=mRNA0001

11  ctg123 . mRNA            1050  9000  .  +  .  ID=mRNA00002;Parent=gene00001;Name=EDEN.2
12  ctg123 . five_prime_UTR  1050  1200  .  +  .  Parent=mRNA0002
13  ctg123 . CDS             1201  1500  .  +  0  Parent=mRNA0002
14  ctg123 . CDS             5000  5500  .  +  0  Parent=mRNA0002
15  ctg123 . CDS	     7000  7600	 .  +  0  Parent=mRNA0002
16  ctg123 . three_prime_UTR 7601  9000	 .  +  .  Parent=mRNA0002

17  ctg123 . mRNA            1300  9000  .  +  .  ID=mRNA00003;Parent=gene00001;Name=EDEN.3
18  ctg123 . five_prime_UTR  1300  1500	 .  +  .  Parent=mRNA0003
19  ctg123 . five_prime_UTR  3000  3300	 .  +  .  Parent=mRNA0003
20  ctg123 . CDS             3301  3902  .  +  0  Parent=mRNA0003
21  ctg123 . CDS	     5000  5500	 .  +  2  Parent=mRNA0003
22  ctg123 . CDS	     7000  7600	 .  +  2  Parent=mRNA0003
23  ctg123 . three_prime_UTR 7601  9000	 .  +  .  Parent=mRNA0003

Lines beginning with ## are pragmas that provide meta-information
about the document.  Blank lines and lines beginning with a single #
are ignored.

Line 0 gives the GFF version using the ##gff-version pragma. Line 1
indicates the boundaries of the region being annotated (a 1,497,228 bp
region named "ctg123") using the ##sequence-region pragma.

Line 2 defines the boundaries of the gene.  Column 9 of this line
assigns the gene an ID of gene00001, and a human-readable name of
EDEN.  Because the gene is not part of a larger feature, it has no
Parent.

Line 3 annotates the transcriptional factor binding site.  Since it is
logically part of the gene, its Parent attribute is gene00001.

Lines 4-10 define the first alternative transcript.  An mRNA line
indicates the start and stop of the spliced transcript as a whole, and
assigns it ID mRNA0001 and Name EDEN.1. Following this are the two
UTRs and four CDS segments, each of which has mRNA00001 as its parent.
Because the CDS segments are coding features, their phase field is
defined.  As it happens, each of the CDS features is an even multiple
of 3, so their phases are all zero.

In a similar manner, lines 11-16 define the second transcript, ID
mRNA00002, Name EDEN.2.  Note that the Parent field of the UTRs and
CDS entries is mRNA00002.

Lines 17-23 define the third transcript, EDEN.3.  Of interest in this
example is that although the UTR and the first CDS partly share the
same exon, this does not change the overall structure of the
GFF3 representation.  Also, because the alternative splicing pattern
changes the reading frame of this transcript, the phase of the second
and third CDS segments has changed.

The canonical representation does not represent exons directly; they
can be reconstructed by combining adjacent UTR and CDS features.  If
desired, you may add the "exon" feature to the mRNA in addition to the
CDS.  The following example shows how exons can be shared among
multiple mRNAs, each of which corresponds to an alternative splicing
pattern.

 ctg123 . mRNA  1050  9000  .  +  . ID=ptr00001;Parent=gene00001
 ctg123 . mRNA  1050  9000  .  +  . ID=ptr00002;Parent=gene00001
 ctg123 . mRNA  1300  9000  .  +  . ID=ptr00003;Parent=gene00001
 ctg123 . exon  1050  1500  .  +  . ID=exon00001;Parent=ptr00001,ptr00002
 ctg123 . exon  1300  1500  .  +  . ID=exon00001;Parent=ptr00003
 ctg123 . exon  3000  3902  .  +  . ID=exon00002;Parent=ptr00001,ptr00003
 ctg123 . exon  5000  5500  .  +  . ID=exon00003;Parent=ptr00001,ptr00002,ptr00003
 ctg123 . exon  7000  9000  .  +  . ID=exon00004;Parent=ptr00001,ptr00002,ptr00003

Introns can be represented using the "intron" feature.

REPRESENTING SPLICED NON-CODING TRANSCRIPTS
-------------------------------------------

For spliced non-coding transcripts, such as those produced by some
processed snRNAs and viruses, use a parent feature of
"noncoding_transcript" and a child of "exon."

PARENT (PART-OF) RELATIONSHIPS
------------------------------

The reserved Parent attribute can be used to establish a part-of
relationship between two features.  A feature that has the Parent
attribute set is interpreted as asserting that it is a part of the
specified Parent feature.

Features must respect the Sequence Ontology Part-Of relationships.  A
Parent relationship between two features that is not one of the
Part-Of relationships listed in SO should trigger a parse exception
Similarly, a set of Parent relationships that would cause a cycle
should also trigger an exception.

The GFF3 format does not enforce a rule in which features must be
wholly contained within the location of their parents, since some
elements of the Sequence Ontology (e.g. enhancers in genes) allow for
distant cis relationships.

THE GAP ATTRIBUTE
-----------------

Protein and nucleotide alignment features typically consist of two
sequences, the reference sequence and the "target", and are not always
colinear.  For example, consider the following alignment between an
EST ("EST23") and a segment of the genome ("Chr3"):

        Chr3  (reference)  1 CAAGACCTAAACTGGAT-TCCAAT  23
        EST23 (target)     1 CAAGACCT---CTGGATATCCAAT  21

Previous versions of the GFF format would represent this alignment as
three colinear segments, but this made it difficult to reconstruct the
gapped alignment.  GFF3 recommends representing gapped alignments
explicitly with the "Gap" attribute.  The Gap attribute's format
consists of a series of (operation,length) pairs separated by spac
characters, for example "M8 D3 M6".  Each operation is a single-letter
code:

       Code      Operation
       ----      ---------

        M        match
        I        insert a gap into the reference sequence
        D        insert a gap into the target (delete from reference)
        F        frameshift forward in the reference sequence
        R        frameshift reverse in the reference sequence

In the alignment between EST23 and Chr3 shown above, Chr3 is the
reference sequence referred to in the first column of the GFF3 file,
and EST23 is the sequence referred to by the Target attribute.  This
gives a Gap string of "M8 D3 M6 I1 M6". The full GFF match line will
read:
          
   Chr23 . Match 1 23 . . . ID=Match1;Target=EST23 1 21;Gap=M8 D3 M6 I1 M6

For protein to nucleotide matches, the M, I and D operations apply to
amino acid residues in the target and nucleotide base pairs in the
reference in a 1:3 residue.  That is, "M2" means to match two amino
residues in the target to six base pairs in the reference.  Hence this
alignment:

 100 atgaaggag---gttattgcgaatgtcggcggt
   1 M..K..E..V..V..I..-..N..V..G..G..

Corresponds to this GFF3 Line:

 ctg123 . nucleotide_to_protein 100 129 . + . ID=match008;Target=p101 1 10;Gap=M3 I1 M2 D1 M4

In addition, the Gap attribute provides <F>orward and <R>everse
frameshift operators to allow for frameshifts in the alignment.  These
are in nucleotide coordinates: a forward frameshift skips forward the
indicated number of base pairs, while a reverse frameshift moves
backwards.  Examples:


 100 atgaaggag---gttattgaatgtcggcggt     Gap=M3 I1 M2 F1 M4
   1 M..K..E..V..V..I...
                        N..V..G..G


 100 atgaaggag---gttataatgtcggcggt        Gap=M3 I1 M2 R1 M4
   1 M..K..E..V..V..I.
                      N..V..G..G

ALIGNMENTS
----------

In the SO, an alignment between the reference sequence and another
sequence is called a "match".  In addition to the generic "match"
type, there are the subclasses "cDNA_match," "EST_match,"
"translated_nucleotide_match," "nucleotide_to_protein_match," and
"nucleotide_motif."

Matches typically contain gaps; matches broken up by large gaps are
usually called "HSPs" (high-scoring segment pair), and previous
incarnations of GFF have handled gapped alignments by breaking up the
alignment into a series of ungapped HSPs.

The SO does not have an HSP type.  Instead, gapped matches are
represented as a single feature that occupies a discontinuous location
on the reference sequence.  Figure 2 shows the same gene as before,
but with a new track added showing an alignment of a sequenced cDNA to
the genome.  For the purposes of illustration, we have shown the
regions of alignment to be exact across the three exons of the second
spliced transcript (EDEN.2).  

The recommended way to represent this alignment is with a single
feature of type "cDNA_match" and a Gap attribute that indicates that
the alignment is in three segments:

 ctg123 . cDNA_match 1050  9000  6.2e-45  +  . 
    ID=match0001;Target=cdna0123 12 2964;Gap=M451 D3499 M501 D1499 M2001

Parsed out, the Target attribute indicates that the sequence named
"cdna0123" between bases 12 and 2964 (in cdna coordinates) aligns to
bases 1050 to 9000 of ctg123.  The Gap attribute is easier to
read when spaces are inserted:

     M451	 match 451 bases
     D3499	 skip 3499 bases in the reference ctg123 sequence
     M501	 match the next 501 bases
     D1499	 skip 1499 bases in the reference ctg123
     M2001	 match the next 2001 bases

Note that the matched region is 2953 bases, which corresponds exactly
to the matching subsequence [12,2964] of the target.  Extra bases in
the cDNA which would cause gaps in the reference sequence would be
indicated using the CIGAR "I" notation.

Another important item to note is that the ID corresponds to the Match
and not to the target sequence.  This avoids the confusion that has
occurred in previous incarnations of GFF which made it impossible to
distinguish between a particular alignment of a target sequence to the
genome and all alignments of a target sequence to the genome.

A limitation of the Gap representation is that the entire alignment
shares the same score (column 6).  To give each component of the match
a separate score, it can be broken across multiple lines as shown
here:

 ctg123 . cDNA_match 1050  1500  5.8e-42  +  . ID=match0001;Target=cdna0123 12 462
 ctg123 . cDNA_match 5000  5500  8.1e-43  +  . ID=match0001;Target=cdna0123 463 963
 ctg123 . cDNA_match 7000  9000  1.4e-40  +  . ID=match0001;Target=cdna0123 964 2964

Notice that the ID is the same across each of the three lines,
indicating that these lines all refer to a single feature, the Match.
Each aligning segment, however has a distinct score and Target region.

The two types of representations can be mixed, allowing large aligned
segments to have their own GFF line and score, while small gaps within
them are represented using a Gap attribute.

Matches can align to either the + or the - strand of the reference
sequence.  This should be denoted in the seventh column of the GFF
line and *not* by changing the order of the start and end positions in
the Target attribute.  To illustrate this, Figure 3 adds an EST pair
to the annotation.  The two ESTs, mjm1123.5 and mum1123.3 correspond
to 5' and 3' EST reads from the same cDNA clone.  The following GFF3
lines describe them:

 ctg123 . EST_match 1200  3200  2.2e-30  +  . 
     ID=match0002;Target=mjm1123.5 5 106;Gap=M301 I1499 M201

 ctg123 . EST_match 5400  9000  7.4e-32  -  . 
     ID=match0003;Target=mjm1123.3 1 502;Gap=M101 I1499 M401

Please note that the subsequence indicated by the Target always uses
the coordinate system of the EST, regardless of the direction of the
alignment.  For the 3' EST, the seventh column contains a "-" to
indicate that the match is to the reverse complement of ctg123.  The
Gap attribute does not change as a consequence of this reverse
complementation, and is read from left to right in the usual manner.

An application may wish to group the EST pair into a single feature.
This can be accomplished by creating an implied cDNA_match that
extends from the left end of the first EST to the right end of the
last EST, and indicating that this cDNA match is the Parent of the two
ESTs:

 ctg123 . cDNA_match 1200  9000  .        .  . ID=cDNA0001

 ctg123 . EST_match  1200  3200  2.2e-30  +  . 
      ID=match0002;Parent=cDNA0001;Target=mjm1123.5 5 106;Gap=M301 I1499 M201

 ctg123 . EST_match  5400  9000  7.4e-32  -  . 
      ID=match0003;Parent=cDNA0001;Target=mjm1123.3 1 502;Gap=M101 I1499 M401

TRANSCRIPT-RELATIVE ALIGNMENTS
------------------------------

The representation of strandedness in nucleotide-to-nucleotide and
protein-to-nucleotide alignments is a common source of confusion in
GFF files.  This section will attempt to explain it.

* Case #1: alignment to a + strand transcript

Consider a pair of EST matches to the genome:

 =============================  genome
     ------------------->       transcript
     ------>        <----       
      EST_A (5')    EST_B (3')

EST_A is a 5' EST and its sequence (as represented in a FASTA file,
for example) is in the same strand as the genomic sequence.  It is
represented as:

 ctg123 . EST_match  1000 1500 . + . ID=match001;Target=EST_A 1 500 +

The strand field in column #7 is "+" indicating that the match is to
the forward strand of the genome.  The optional strand field in the
Target attribute is also +, indicating that the alignment is to the
plus strand of the implied underlying transcript.

Let us now consider EST_B , which is a 3' EST. Its sequence as
represented in the FASTA file aligns to the reverse complement of the
genomic sequence.  It is represented as:

 ctg123 . EST_match  2000 2500 . + . ID=match002;Target=EST_B 1 500 -

The strand field in column #7 is "+" indicating that the match is to a
transcript feature on the forward of the genome.  The strand field in
the Target attribute is -, indicating that the EST sequence should be
reverse complemented in order to align to the underlying transcript.

* Case #2: alignment to a - strand transcript

Here is the opposite case:

 =============================  genome
     <--------------------      transcript
      ------>        <----       
      EST_D (3')  EST_C (5')

In this case, the 5' EST_C aligns to the reverse complement of the
forward strand of the genome, while the 3' EST_D aligns to the forward
strand directly.  These are represented as follows:

 ctg123 . EST_match  2000 2500 . - . ID=match001;Target=EST_C 1 500 +
 ctg123 . EST_match  1000 1500 . - . ID=match001;Target=EST_D 1 500 -

The first line indicates that the transcript is on the - strand of the
genome, and that EST_C aligns to the transcripts forward strand.  The
second line uses - in the 7th column to indicate that the transcript
is on the minus strand, and - in the Target field to indicate that
EST_D aligns to the minus strand of the transcript.

  ===================================================================
  Confused?  Just remember that for purposes of display, the source
  and target strands will be multipled together.  A +/+ or -/-
  alignment indicates that the reference sequence and the target
  sequence can be aligned directly.  A +/- or -/+ alignment indicates
  that the target must be reverse complemented in order to align to
  the plus strand of the reference sequence.  
  ===================================================================

A similar rule applies to TBLASTX alignments, which rely on matching
the six-frame translation of the source to the six-frame translation
of the target.  Consider the case of two genomes that align together
in the forward direction, whose alignment is supported by translations
of genes A and B, one of which is on the plus strand, and the other on
the minus strand:

  =============================>  genome X
       ------>        <----
       gene A          gene B
  =============================>  genome Y

These two alignments will be  represented as:

  X TBLASTX translated_nucleotide_match 1000 1500 . + . ID=matchA;Target=Y 500 1000 +
  X TBLASTX translated_nucleotide_match 2000 2500 . - . ID=matchB;Target=Y 1500 2000 -

Note that the first alignment is +/+ and the second is -/-.  Both
indicate that the sequences of genomes X and Y can be aligned
directly.

Now we look at the case of two genomes that align in the antiparallel
direction:

  =============================>  genome X
       ------>        <----
       gene A          gene B
  <=============================  genome Y


These two alignments will be represented as:

  X TBLASTX translated_nucleotide_match 1000 1500 . + . ID=matchA;Target=Y 500 1000 -
  X TBLASTX translated_nucleotide_match 2000 2500 . - . ID=matchB;Target=Y 1500 2000 +

The first match indicates that a plus strand feature of genome X
aligns to a minus strand feature of genome Y.  The second match
indicates that a minus strand feature of genome X aligns to a plus
strand feature of genome Y.  In both cases, the result is to align the
plus strand of genome X to the minus strand of genome Y.


ONTOLOGY ASSOCIATIONS AND DB CROSS REFERENCES
---------------------------------------------

Two reserved attributes, Ontology_term and Dbxref, can be used to
establish links between a GFF3 feature and a data record contained in
another database.  Ontology_term is reserved for associations to
ontologies, such as the Gene Ontology.  Dbxref is used for all other
cross references.  While there is no firm boundary line between these
two concepts, curators tend to treat ontology asociations differently
and hence ontology terms have been given their own reserved attribute
label.

The value of both Ontology_term and Dbxref is the ID of the cross
referenced object in the form "DBTAG:ID".  The DBTAG indicates which
database the referenced object can be found in, and ID indicates the
identifier of the object within that database.  IDs can contain
unescaped colons but DBTAGs cannot, so parsing code should split on
the first colon encountered in the attribute value.

The format of each type of ID varies from database to database.  An
authoritative list of databases, their DBTAGs, and the URL
transformation rules that can be used to fetch the objects given their
IDs can be found at this location:

   ftp://ftp.geneontology.org/pub/go/doc/GO.xrf_abbs

Further details can be found here:

   ftp://ftp.geneontology.org/pub/go/doc/GO.xrf_abbs_spec

Here are some common examples:

* a dbxref to an EMBL sequence accession number:

  Dbxref="EMBL:AA816246"

* a dbxref to an NCBI gi number:

  Dbxref="NCBI_gi:10727410"

* a Ontology_term referring to a GO association

  Ontology_term="GO:0046703"

OTHER SYNTAX
------------

Comments are preceded by the # symbol.  Meta-data and directives are
preceded by ##.  The following directives are recognized:

  ##gff-version 3        
	The GFF version, always 3 in this spec.  This must
	be the topmost line of the file.

  ##sequence-region seqid start end
        The sequence segment referred to by this file, in the format
        "seqid start end".  This element is optional, but strongly
        encouraged because it allows parsers to perform bounds
        checking on features. There may be multiple ##sequence-region
        directives, each corresponding to one of the reference
        sequences referred to in the body of the file.

  ##feature-ontology URI
        This directive indicates that the GFF3 file uses the ontology 
	of feature types located at the indicated URI or URL.
	Multiple URIs may be added, in which case they are
        merged (or raise an exception if they cannot be merged).  The
        URI for the base Sequence Ontology is:

	  urn:lsid:song.sourceforge.net:so/solite/2003-02-24

        This directive may occur several times per file.  If no
	feature ontology is specified, then the Sequence Ontology
        is assumed.

  ##attribute-ontology URI
        This directive indicates that the GFF3 uses the ontology of
        attribute names located at the indicated URI or URL.  This
        directive may appear multiple times to load multiple URIs, in
        which case they are merged (or raise an exception if merging
        is not possible).  Currently no formal attribute ontologies
	exist, so this attribute is for future extension.

  ##source-ontology URI
        This directive indicates that the GFF3 uses the ontology of
        source names located at the indicated URI or URL.  This
        directive may appear multiple times to load multiple URIs, in
        which case they are merged (or raise an exception if merging
        is not possible).  Currently no formal source ontologies
        exist, so this attribute is for future extension.

  ###
        This directive (three # signs in a row) indicates that all
        forward references to feature IDs that have been seen to this
        point have been resolved.  After seeing this directive, a
        program that is processing the file serially can close off any
        open objects that it has created and return them, thereby
        allowing iterative access to the file.  Otherwise, software
        cannot know that a feature has been fully populated by its
        subfeatures until the end of the file has been reached.  It
	is recommended that complex features, such as the canonical
	gene, be terminated with the ### notation.

   ##FASTA
	This notation indicates that the annotation portion of the
	file is at an end and that the remainder of the file 
	contains one or more sequences (nucleotide or protein)
	in FASTA format.  This allows features and sequences to
	be bundled together.  Example:

   ##gff-version   3
   ##sequence-region   ctg123 1 1497228       
   ctg123 . gene            1000  9000  .  +  .  ID=gene00001;Name=EDEN
   ctg123 . TF_binding_site 1000  1012  .  +  .  ID=tfbs00001;Parent=gene00001
   ctg123 . mRNA            1050  9000  .  +  .  ID=mRNA00001;Parent=gene00001;Name=EDEN.1
   ctg123 . five_prime_UTR  1050  1200  .  +  .  Parent=mRNA0001
   ctg123 . CDS             1201  1500  .  +  0  Parent=mRNA0001
   ctg123 . CDS             3000  3902  .  +  0  Parent=mRNA0001
   ctg123 . CDS             5000  5500  .  +  0  Parent=mRNA0001
   ctg123 . CDS             7000  7600  .  +  0  Parent=mRNA0001
   ctg123 . three_prime_UTR 7601  9000  .  +  .  Parent=mRNA0001
   ctg123 . cDNA_match 1050 1500  5.8e-42  +  . ID=match0001;Target=cdna0123+12+462
   ctg123 . cDNA_match 5000 5500  8.1e-43  +  . ID=match0001;Target=cdna0123+463+963
   ctg123 . cDNA_match 7000 9000  1.4e-40  +  . ID=match0001;Target=cdna0123+964+2964
   ##FASTA
   >ctg123
   cttctgggcgtacccgattctcggagaacttgccgcaccattccgccttg
   tgttcattgctgcctgcatgttcattgtctacctcggctacgtgtggcta
   tctttcctcggtgccctcgtgcacggagtcgagaaaccaaagaacaaaaa
   aagaaattaaaatatttattttgctgtggtttttgatgtgtgttttttat
   aatgatttttgatgtgaccaattgtacttttcctttaaatgaaatgtaat
   cttaaatgtatttccgacgaattcgaggcctgaaaagtgtgacgccattc
   gtatttgatttgggtttactatcgaataatgagaattttcaggcttaggc
   ttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggctt
   aggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttag
   aatctagctagctatccgaaattcgaggcctgaaaagtgtgacgccattc
   ...
   >cnda0123
   ttcaagtgctcagtcaatgtgattcacagtatgtcaccaaatattttggc
   agctttctcaagggatcaaaattatggatcattatggaatacctcggtgg
   aggctcagcgctcgatttaactaaaagtggaaagctggacgaaagtcata
   tcgctgtgattcttcgcgaaattttgaaaggtctcgagtatctgcatagt
   gaaagaaaaatccacagagatattaaaggagccaacgttttgttggaccg
   tcaaacagcggctgtaaaaatttgtgattatggttaaagg

       For backward-compatibility with the GFF version output by the
       Artemis tool, a GFF line that begins with the character >
       creates an implied ##FASTA directive.

Send comments to us at flybase-help AT morgan.harvard.edu